Balikid Balikid

14-05-2017
Mathematics

contestada

The theoretical probability that a pop song plays on your MP3 player is 0.45. There are 80 songs on your MP3 player. How many of the songs are pop songs?

___ songs on your MP3 player are pop songs.

Respuesta :

mreijepatmat mreijepatmat

14-05-2017

If the probability of pop songs is 0.45, that means the expected value of the number of pop songs is .45 x 80 =36 pop songs

Answer Link

Otras preguntas

8 x(11-3) + 9 with and exponent of 2

Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT -5' produces a polypeptide that

Rancher John wants to build a three-sided rectangular fence near a river, using 280 yards of fencing. Assume that the river runs straight and that John need not

A truck is traveling with speed 5 v and hits a super ball traveling in the opposite direction at speed 3 v. Assuming the collision is elastic, what is the appro

The U.S. Department of Education reported that in 2007, 67% of students enrolled in college or a trade school within 12 months of graduating from high school, i

The City of Island Grove uses encumbrance accounting and its fiscal year ends on June 30. On May 6, a purchase order was approved and issued for supplies in the

. For 2A + 3B → 2C, [A]0 = 0.15, [B]0 = 0.12, and the initial rate is 0.10 mol/Ls. Assume that the reaction described above is first order in both reactants A a

Jane has worked for 5 years in a professional organization that focuses on high specialization, and her productivity is expected to be high. Should her manager

The wear resistance of a steel shaft is to be improved by hardening its surface by increasing the nitrogen (N) content within an outer surface layer as a result

Exponential functions