skhallskidz skhallskidz

09-05-2022
Biology

contestada

What is the correct numerical sequence for unlocking "DNA Structure?"

Respuesta :

howardclemingtime howardclemingtime

09-05-2022

Answer:

3'TGACGACTACAACTTAATCT

Explanation:

Adenine bonds with thymine; guanine bonds with cytosine. This is the complement DNA sequence.

Answer Link

Otras preguntas

The graph of this line shows the total amount Katrina earns for working a corresponding number of hours. How much did Katrina earn for working 7 hours?

Which equation can be used to prove 1 + tan2(x) = sec2(x)? StartFraction cosine squared (x) Over secant squared (x) EndFraction + StartFraction sine squared (x)

Find the area of the region under the graph of the function f on the interval [1,25]. f(x)= 8/√x square units

(Complex present value) You would like to have $52000 in 14 years. To accumulate this amount, you plan to deposit each year an equal sum in the bank, which

A coordinate plane. Quadrant 1 is the top right quadrant, quadrant 2 is the top left, quadrant 3 is the bottom left, and quadrant 4 is the bottom right. A point

Assume that Bonita and Swifty use the earnings approach for revenue recognition. Bonita returned to Swifty Inc. 6 damaged fuses. Swifty accepted the return and

Write a program that has a method named findSmallest which accepts a vector of 6 jokes and return the smallest one among them . If there are multiple smallestst

What are some of the things that Islam has in common with the precepts, or main ideas, behind these other religions?

Which organism in the food web can be a primary consumer and a secondary consumer? A.Bird B.Owl C.Rabbit D.Mouse

Either use an appropriate theorem to show that the given set, W, is a vector space, or find a specific example to the contrary. Р Ax= o r S 3p + 2q = -5s -p= -3