GlowingPie44
GlowingPie44
10-10-2021
English
contestada
please answer it properly
Respuesta :
SilverKitten
SilverKitten
10-10-2021
1. Sanitise your hands.
2. Wear a mask.
3. Stay 2 metres apart.
4. Avoid touching your eyes, nose or mouth if your hands are not clean.
5. Keep surfaces clean.
Answer Link
VER TODAS LAS RESPUESTAS ( 87+ )
Otras preguntas
Identify an example of an ethical framework. (1.1)
If my billing date is 15th and my due date is 5th of the next month, and I bought a product on the 14th using my credit card, does that mean I only get 21 days
The foot of the perpendicular drawn from the point (1,8,4) on the line joining the points (0,−11,4) and (2,−3,1) isO (4,5,2)O (−4,5,2)O (4,5,−2)O (4,−5,2)
What can the reader infer based on paragraphs 9-13? Rachel believes that Matthew enjoys going to the zoo in his spare time. Marilla is excited about Rachel d
Which theme topic does the following excerpt from Julius Caesar Act Ill reveal? Cassius. Pardon, Caesar! Caesar, pardon! As low as to thy foot doth Cassius fall
A steel wire with a Young's modulus of 200 GPa and a cross-sectional area of 10 mm² is stretched by a force of 2000 N. What is the percentage increase in the le
Read the following extract carefully and answer the questions that follow:"This requires some little reflection;Perhaps on the whole it might bring me luck,And
Roger identifies his most important priority as his schoolwork. Thus, when he's planning his day, what should Roger do first? Clean his room. Do the laundry. St
Of the DNA sequences below, which would probably be the harder to determine? a) CGATATATATATATACGATGGCATCACGAGCTGCATTCGCA b) CGATATATATATATACGATGGCATCACGAGCTGCA
Lyndon B. Johnson's statement supports the conclusion that intervention in Vietnam led to which of the following results? A. Impeachment of the president and ot
