dashnerchelsey dashnerchelsey

06-09-2021
Mathematics

contestada

65124 rounded to the nearest thousand

Respuesta :

rorostar10p8wi2c rorostar10p8wi2c

06-09-2021

Correct Answer is 65000

Answer Link

gallingnotofficial gallingnotofficial

06-09-2021

Answer:

65000 is the right answer, hope it helps ^w^

Answer Link

Otras preguntas

What were large farming estates worked by enslaved people

Anyone know the answer to this?

Do you think an observer on another planet in the solar system might see eclipses? Why or why not?

85 POINTS!! Hello, can someone please help me with this one question? It's on a practice quiz for the unit test and I need help since I'm, like, clueless lol...

In eukaryotes, there are _______________ codons that specify amino acids. (0.5 pt.) (A) 21 (B) 24 (C) 61 (D) 64 (E) 60

Clyde is baking and the recipe required 1, 1/3 cups of flour. Clyde has 2 cups of flour but he is doubling the recipe to make twice as much. How much more flour

______________ are units within an organization that receive services from other units within the organization. A. End-usersB.Internal customersC. Distribution

Classify each of the following compounds as an acid, base, or both. Be sure to answer all parts 1. CH3CH2OH 2. CH3CH2CH2CH3 3. CH3CO2CH3

How many amino acids would be included in the polypeptide encoded by the following mRNA S'GCCACCAUGGGCCAAUUACGAAGGUUUUGCUGACCAGGUUUUCAAGAA3 a. 7 b. 8 c. 9 d. 10

Describe the idea of thinking of sentences as having both a ""surface structure"" and a ""deep structure"". Also answer the following: does ""movement"" happen