Seudónimo Seudónimo

08-12-2016
Social Studies

contestada

Did Eli Whitney contribute or like social Darwinism?

Respuesta :

Аноним Аноним

08-12-2016

I think he contributed

Answer Link

Otras preguntas

from"If These Airplanes Could Talk" Which claim relies on insufficient evidence

Logan needs help with biology because he is having trouble understanding the process of protein synthesis, and his answer to a question needs to be fixed. In th

Which one of the following pairs contains isoelectronic species? a) Kr, Br- b) S, O c) Cr₂, V₂ d) Ne, F e) Cr, Mo f) K, Na

The correct electronic configuration and spin-only magnetic moment (BM) of Gd³⁺ (z = 64), respectively, are:a. [Xe] 5f⁷ and 7.9b. [Xe] 4f⁷ and 7.9c. [Xe] 5f⁷ an

Of the DNA sequences below, which would probably be the harder to determine? a) CGATATATATATATACGATGGCATCACGAGCTGCATTCGCA b) CGATATATATATATACGATGGCATCACGAGCTGCA

What temperature change from0°would increase the speed of sound by 1.0%?

invented by George B. Hansburg in Germany in 1919, and originally were made of wood. When an American company ordered the first large shipment of the new toy in

It takes a constant force of 18 pounds applied at a 55° angle to pull a rolling cart 20 feet across the ground. What is the work done by the force? 185.3 ft·lb

Which of the following is a pricing strategy that turns the typical assumption about price-demand relationships on its head? a) Penetration Pricing b) Skimming

Evaluate the key questions that forensic anthropologists have to answer before and during forensic anthropology analysis