13-11-2016
Computers and Technology

contestada

In a reference what does online mean?

Respuesta :

15-11-2016

controlled by or connected to another computer or to a network.

Answer Link

Otras preguntas

hellppppopppopooommvfuhsnduddk

Which is a reasonable first step that can be used to solve the equation 4X+3(x+2) = 5(2x-3)?Distribute the 3 to x + 2, and distribute the 5 to (2x - 3).O Combin

1. !!!Please hurry!!!!What are four metals other than iron that can be made to exhibit magnetic properties?

How would a growing economy generate good feelings? (Westward Expansion, Lesson 1, American Foreign Policy :/)

A restriction enzyme is coded for: AT!GC How long would the Base Pair fragments be for this DNA sequence? AGTCGAGTATATGCATGGCCGCGAT Question 1 options: 14 and 1

The base radius of a cone is expanding at the rate of 1in/min while its height is shrinking at the rate of 3in/min. How fast is the volume of this cone changing

Last year Michelle adopter a pet rabbit sence it was adopted the rabbit weight has increased from 1 1/4 to 2 1/4 by what percentage has the rabbit weight increa

Which of the following compositions will map the red figure onto the blue figure?

Select the response which answers the question: Est-ce que tu aimes les feuilletons? Elle adore les feuilletons. Tu aimes les feuilletons. J'aime les films.

g You need to create a program that will read the scores from the CSV file, pass the scores as a list to the finalGrade function, and display the resulting fina