ription
ription
08-01-2021
Biology
contestada
Write Three food chains with at least 3 links
Respuesta :
2304007
2304007
08-01-2021
Grass-> Cow -> Human
Grass -> Bunnies -> Foxes
Mice-> Snakes -> Hawks
Answer Link
VER TODAS LAS RESPUESTAS ( 58+ )
Otras preguntas
Of the DNA sequences below, which would probably be the harder to determine? a) CGATATATATATATACGATGGCATCACGAGCTGCATTCGCA b) CGATATATATATATACGATGGCATCACGAGCTGCA
Four students A, B, C and D of Class X measured the pH of the given samples of distilled water, 0.1 M solution of ethanoic acid, 0.1 M solution of hydrochloric
A 40-year-old woman presents with inflammatory papules on her face and facial flushing when she drinks a glass of wine. What is the most likely diagnosis? 1) Ro
How has the model of medicine shifted from a general practitioner to a specialist?
Answer questions using table. 1.) What is the probability that a randomly selected person is either a Culinary Arts major or an ITS major? 2.) What is the pr
Which of the following would be valid complications for CAD? (Select all that apply) a) MI b) Pancreatitis c) Peripheral neuropathy d) Stroke
A relation R on the set of complex numbers is defined by z1Rz2 if and oly if z1−z2/z1+z2 is real Show that R is an equivalence relation.A. R is reflexiveB. R is
If th A pipelined processor has a clock rate of 2.5 GHz and executes a program with 1.5 million instructions. The pipeline has five stages, and instructions are
Explain the family’s reaction when she first gets off the boat. What is Charlotte’s attitude toward them? This is for the true confessions of Charlotte Doyle.
A student added dilute HCl to a test tube containing zinc granules. Which of the following observations are correct?I. Zinc surface became dull and black.II. A
