jls7281 jls7281

08-01-2021
Biology

contestada

TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA

Respuesta :

mathsbeginer mathsbeginer

12-01-2021

Answer:

I don't know the answer

Explanation:

is is this even a question cos I don't think so.

Answer Link

Otras preguntas

Trapezoid Lmno with vertices L(-12,0) M (-4,-4) N(-4,-8) and O(-12,-12):k=3/4

Adventure Travel has an Adjusted Trial Balance for Year Ended December 31, 20XX with the following account balances: DEBITS: Cash: 25,000; Accounts Receivable:

Toss three fair coins. Let X be the random variable that uses the rule of assignment: (2 × number of tails) − number of heads. For example if the outcome is TTH

aiderr moi pour cette petite exercice je suis nul en mathh et cest pour lundiii a l aideee

COMPLETE ANSWER THE ANSWER TO THE QUESTION IS I'M GOING TO VOTE BRAINLIEST Directions: Create a DIALOG presenting the positive effects of having good communicat

Please help me with this!!!!

PLS HELP! Which statistic would best help someone decide whether or not to pursue a postsecondary degree? taking the test right now A. The average unemployment

prove the quadrilateral is a parallelogram by showing opposite sides are congruent A(-7,5) B(6,5) C(4,-2) D(-9,-2)

Which measurement of job satisfaction identifies key elements in a job, such as the work, skills needed, supervision, present pay, promotion opportunities, cult

It is apparent Jourdon has no intention of returning to the plantation and working for the colonel. What is his primary purpose in writing a response to Colonel