mh14158 mh14158

06-01-2021
History

contestada

How did Martin Luther feel about indulgences? Why?

Respuesta :

mandydavidson0018 mandydavidson0018

06-01-2021

Answer:

drew believers away from the one true source of salvation or faith in Christ

Explanation:

i did a search UvU i hope this helps

Answer Link

Otras preguntas

what is the American government doing about poverty amung the youth?

Rayna provides a significant amount of information to others across a wide array of products, including durables and nondurables, services, and store type. She

How does Maya Lin want to be know? a. as an architect and an artist b. as a monument designer c. as a landscaper and an architect d. as someone who is good a

A wire is oriented along the axis. It is connected to two batteries, and a conventional current of 1.4 A runs through the wire in the direction. Along 0.20 m of

Example: An alarm turns off after you buckle your seatbelt. Step 1: Identify the behavior. Answer: Buckling Step 2: Identify whether the consequence will likely

You have just arrived on the scene of an agricultural business and see three men coming out of a building, choking and holding their heads. One of the men tell

Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT -5' produces a polypeptide that

What is another name for supplementary angles?

If this economy moved from point P to point N, then a. there would be no gain in either engines or tvs. b. it would be producing more engines and more tvs tha

Which goal was established by the Paris Peace Accords in 1973? A.)uniting Vietnam as one country under democratic rule B.)establishing a plan to properly train