alinajimenez134 alinajimenez134

06-10-2020
Biology

contestada

Which characteristic makes a cell membrane selectively permeable?

the thickness of the membrane
the chemical nature of the membrane
the rigid nature of the membrane
the smooth outside of the membrane

Respuesta :

huneycuttaeh huneycuttaeh

09-10-2020

Answer:A selectively permeable cell membrane is one that allows certain molecules or ions to pass through it with active or passive transport.

Explanation:

Answer Link

Otras preguntas

Use the following DNA sequence to answer these questions.Make sure to explain/justify your answers. This piece of DNA is 29 bases long. 5' GACCGATCGGCTAAGCATCAC

A paint manufacturer uses a machine to fill gallon cans with paint (1 gal = 128 ounces). The manufacturer wants to estimate the mean volume of paint the machine

Find the center and radius of the equation 2x²+2y²-32x+12y+90=0

The relationship between the procedure code and the diagnosis that shows medical necessity is called which of the following? a) Compliance b) Documentation c) C

De que se trata el parrafo

Arrange the code boxes, in the correct positions in order to obtain loop which executes to body with the level variable going through values 5,3,1 in the same o

Sexual selection results in nonrandom mating. Indicate which type of sexual selection is being exhibited in these examples.Intersexual: Intrasexual: Both: a. Ne

. Given an optimal risky portfolio with expected return of 6%, standard deviation of 23%, and a risk free rate of 3%, what is the slope of the best feasible CAL

Calculate how many grams of water form when 1.11 g of O_{2} reacts completely given the following equation: 2C 4 H 10(g) +13O 2(g) 8CO 2(g) +10H 2 O (g)

Melanie cuts a rectangle