maryjaneterry536 maryjaneterry536

14-05-2020
Physics

contestada

When traveling in a car and turning it the right which way does your body go and why

Respuesta :

14-05-2020

Your body goes left due to momentum. Your body is actually still going in a forward motion, but the car is turning right forcing the car to push into you on the left side. So it creates the illusion of your body moving left.

Answer Link

Otras preguntas

You are caring for a 6-year-old child with a swollen, painful deformity to the left forearm. as you communicate with the parents of this child, you should:

I need a poem about cyber bullying and include metaphor, simile, etc

Which points in the scatter plot are outliers? Point A Point F Point H Point K Point M

A store manager set up a cardboard display to advertise a new brand of perfume. The display is a square pyramid whose base is 18 inches on each side.The heigh

If 20.60 ml of 0.0100 m aqueous hcl is required to titrate 30.00 ml of an aqueous solution of naoh to the equivalence point, what is the molarity of the naoh so

A banquet has charges $750 to feed a large party. Each person must also pay $3.50 for a tip. If divided equally, how many people would need to participate for t

Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3

If the number of particles in a mole is 6.022x1023, what is the total mass of 1.81×1024 particles of nitrogen gas (N2)? A. 42 g B. 4.2 g C. 84 g D. 8.4 g

Hello help my please Q2,3!!

In the space below, identify an islamic state, mongol khanate, city-state, and decentralized form of feudalism that developed a new form of governance. provide