sidkid711 sidkid711

14-04-2020
Law

contestada

Public opinion ________________.
A.interests but doesn't concern lawmakers

B.is irrelevant to lawmakers

C.often shapes what lawmakers do

D.is often formed by lawmakers

Respuesta :

dokunmuforjesus dokunmuforjesus

14-04-2020

Answer:

however it makes the lawmakers to know what they can do to improve thier interest.

Answer Link

julierobaina julierobaina

14-04-2020

I think it would be c

Answer Link

Otras preguntas

Neha used 4 banana and 5 oranges I her fruit salad. Daniel used 7 bananas and 9 oranges. Did Neha and Daniel use the same ratio of bananas to oranges? I’d not,

For a class trip, a teacher bought 25 student tickets and 5 adult tickets. Write an expression for the total cost of the tickets purchased?

A 5 N force pushes on the right side of a box. At the same time, a 10 N force pushes on the left side of the box. What happens to the box? A. It is moved to the

Enthusiastic attachments among large numbers of people for particular styles of appearance or behavior. Riot Fad Public Opinon Relative Deprivation Theory Propa

5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand

Which best explains why Brutus chooses to commit suicide at Philippi? Caesar's ghost urges him to do it, and Brutus is too afraid of the ghost to disobey it.

A pine car derby car rolls along a track with velocity v(t) = 3 + 2t − t 2 feet per second. if it starts at time t = 0, after how many seconds will its position

How can I write a group of five friends are Sharing 2 pounds of trail mix into a division problem

Given right triangle RST, what is the value of sin(S)?A) 5/13B) 5/12C) 12/13D) 13/12

Patrick Henry made this statement in his speech at the Virginia Ratifying Convention. The purpose of the speech was to explain why he opposed ratifying the Cons