alexcanahuati alexcanahuati

06-09-2019
Mathematics

contestada

please I need help how do you solve 5 + x to the 2nd power = 2x2 + 13

Respuesta :

06-09-2019

Answer:

it has no real solutions

Step-by-step explanation:

5 + x² = 2x² + 13

first simplify by moving the 2x² to the left and the 5 to the right:

x² - 2x²= 13 - 5

- x²= 8

x = +/- √-8 has no (real) solutions

Answer Link

Otras preguntas

x 4 6 9 11 15 P(x) 0.20 0.34 0.15 0.22 0.09 This table shows a probability distribution for a discrete random variable. What is the mean of this discrete random

How did the colonists justify their protests and ultimate rebellion? What sources did they call on? What philosophies were influential? How was the language of

Which bag has more fruit? Use the ratios to justify your answer. The first bag, because the ratio is greater. The first bag, because the ratio is smaller. The s

During March, a firm expects its total sales to be $160,000, its total variable costs to be $95,000, and its total fixed costs to be $25,000. The contribution m

Do you know anyone who has ever been to jail? Why did they go? Do you think that crime deserved the time they got?

What is the maximum number of amino acids in a peptide that would be produced from the following mRNA sequence: 5′ AAUCCGUAAAUGAGACCGUCGAUCAAUUAGCG 3′?

24-12x<6x-30 what is x

What is the equation of the line that passes through the points: (1,-2) and (3,-8)

One of the reasons we promote PA is the belief that it has the ability to positively affect well-being, psychological distress, and feelings of fatigue. After a

Which data set suggests no association between the two variables? A) A B) B C) C D) D